Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4107849
End position: 4107878
Length: 30

DNA sequence
>NC_013929, from 4107849 to 4107878 (30 bp); Streptomyces scabiei 87.22 CGCGGGCGTGCGGGGGTGTGCGTGGGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4107175-4108101	Sequence	SCAB_36311 - polysaccharide/chitin/xylan deacetylase (Protein is coded in complementary strand; from 4108101 to 4107175)