Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4113296
End position: 4113340
Length: 45

DNA sequence
>NC_013929, from 4113296 to 4113340 (45 bp); Streptomyces scabiei 87.22 TGCCCGCGTCCCCGTTGTCCTCGCCCCCGTTGTCCTCGTCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4112284-4113345	Sequence	SCAB_36361 - transcription attenuator (Protein is coded in complementary strand; from 4113345 to 4112284)