Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4124278
End position: 4124301
Length: 24

DNA sequence
>NC_013929, from 4124278 to 4124301 (24 bp); Streptomyces scabiei 87.22 CTCGTGCACGTGGTCGTGGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4124252-4125361	Sequence	SCAB_36461 gcp O-sialoglycoprotein endopeptidase (Protein is coded in complementary strand; from 4125361 to 4124252)