Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4158374
End position: 4158400
Length: 27

DNA sequence
>NC_013929, from 4158374 to 4158400 (27 bp); Streptomyces scabiei 87.22 GCGGCCTTGGCGGCCTTGGCCGCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4158011-4158430	Sequence	SCAB_36921 rplW 50S ribosomal protein L23 (Protein is coded in complementary strand; from 4158430 to 4158011)