Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4221290
End position: 4221314
Length: 25

DNA sequence
>NC_013929, from 4221290 to 4221314 (25 bp); Streptomyces scabiei 87.22 GCGGGGCCGGGCGGCTCGGGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4221179-4222726	Sequence	SCAB_37491 - dehydrogenase (Protein is coded in complementary strand; from 4222726 to 4221179)