Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4295439
End position: 4295462
Length: 24

DNA sequence
>NC_013929, from 4295439 to 4295462 (24 bp); Streptomyces scabiei 87.22 CAGCGGCTCAGCGGCTCAGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4295463-4295912	Sequence	SCAB_38181 - hypothetical protein (Protein is coded in complementary strand; from 4295912 to 4295463)