Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4346251
End position: 4346274
Length: 24

DNA sequence
>NC_013929, from 4346251 to 4346274 (24 bp); Streptomyces scabiei 87.22 GTGACCGTGACCGTGACCGTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4344990-4346255	Sequence	SCAB_38741 - pyridoxal-5'-phosphate dependent aminotransferase