Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4426360
End position: 4426407
Length: 48

DNA sequence
>NC_013929, from 4426360 to 4426407 (48 bp); Streptomyces scabiei 87.22 CCGGAACCGGAACCCGAACCGGAGCCGGACCCCGAACCGGAGCCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4425856-4426680	Sequence	SCAB_39381 - hypothetical protein (Protein is coded in complementary strand; from 4426680 to 4425856)