Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4537110
End position: 4537136
Length: 27

DNA sequence
>NC_013929, from 4537110 to 4537136 (27 bp); Streptomyces scabiei 87.22 CTTGGCCGCCTTCGCCGCCTTCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4535083-4537161	Sequence	SCAB_40351 - peptidase (Protein is coded in complementary strand; from 4537161 to 4535083)