Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4595210
End position: 4595254
Length: 45

DNA sequence
>NC_013929, from 4595210 to 4595254 (45 bp); Streptomyces scabiei 87.22 CGCGCTCCGCCTCGGCCCGCTCCGCCGCGACCCGTTCGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4594543-4597875	Sequence	SCAB_40761 tmk thymidylate kinase (Protein is coded in complementary strand; from 4597875 to 4594543)