Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4598150
End position: 4598194
Length: 45

DNA sequence
>NC_013929, from 4598150 to 4598194 (45 bp); Streptomyces scabiei 87.22 TCTTCGCCGCGGCCGTCTTCGAAGCAGCCGTCTTCGCGGCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4598089-4600935	Sequence	SCAB_40781 topA DNA topoisomerase I (Protein is coded in complementary strand; from 4600935 to 4598089)