Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4658247
End position: 4658291
Length: 45

DNA sequence
>NC_013929, from 4658247 to 4658291 (45 bp); Streptomyces scabiei 87.22 GCCTTCTTCGTAGCCGTCTTCTTCATGGCCGCCTTCCTCGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4657266-4658375	Sequence	SCAB_41301 - endonuclease/N-glycosylase (Protein is coded in complementary strand; from 4658375 to 4657266)