Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4669667
End position: 4669690
Length: 24

DNA sequence
>NC_013929, from 4669667 to 4669690 (24 bp); Streptomyces scabiei 87.22 GGGAACGGCAACGGGAACGGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4667541-4669862	Sequence	SCAB_41401 - penicillin-binding transpeptidase/transglycosylase