Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4714965
End position: 4715009
Length: 45

DNA sequence
>NC_013929, from 4714965 to 4715009 (45 bp); Streptomyces scabiei 87.22 CCGTACGCGCCCTGCCCGTACGCACCCGGCCCGACCCCGCCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4714269-4716455	Sequence	SCAB_41811 - serine-threonine protein kinase (Protein is coded in complementary strand; from 4716455 to 4714269)