Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4730985
End position: 4731034
Length: 50

DNA sequence
>NC_013929, from 4730985 to 4731034 (50 bp); Streptomyces scabiei 87.22 TCCCCGGTCAGCCCCGCTCAGCCCCGCTCAGCCCCGCTCAGCCCCGCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4731033-4731566	Sequence	SCAB_42001 - hypothetical protein (Protein is coded in complementary strand; from 4731566 to 4731033)