Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4752515
End position: 4752539
Length: 25

DNA sequence
>NC_013929, from 4752515 to 4752539 (25 bp); Streptomyces scabiei 87.22 GGGCCGGGTCGCGCCGGGCCGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4752414-4754093	Sequence	SCAB_42201 - spermidine synthase (Protein is coded in complementary strand; from 4754093 to 4752414)