Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4764091
End position: 4764114
Length: 24

DNA sequence
>NC_013929, from 4764091 to 4764114 (24 bp); Streptomyces scabiei 87.22 TCGCCGTCGTCGTCGCCCTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4764088-4764633	Sequence	SCAB_42281 - hypothetical protein (Protein is coded in complementary strand; from 4764633 to 4764088)