Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4765767
End position: 4765802
Length: 36

DNA sequence
>NC_013929, from 4765767 to 4765802 (36 bp); Streptomyces scabiei 87.22 GGCGACGACGTCGGCGATGTCGTCGGCGCCGACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4764793-4767408	Sequence	SCAB_42291 clpB chaperone ClpB (Protein is coded in complementary strand; from 4767408 to 4764793)