Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4848124
End position: 4848147
Length: 24

DNA sequence
>NC_013929, from 4848124 to 4848147 (24 bp); Streptomyces scabiei 87.22 CGGACGGGGACGCCGACGGGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4847625-4849265	Sequence	SCAB_43121 - protein kinase (Protein is coded in complementary strand; from 4849265 to 4847625)