Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4858215
End position: 4858271
Length: 57

DNA sequence
>NC_013929, from 4858215 to 4858271 (57 bp); Streptomyces scabiei 87.22 CCGGTCGTCGGGCGGTCAGCCGGCCGTCGGGTGGTCAGCCGGCCGTCGGGTCGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4858269-4858877	Sequence	SCAB_43231 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 4858877 to 4858269)