Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4979844
End position: 4979888
Length: 45

DNA sequence
>NC_013929, from 4979844 to 4979888 (45 bp); Streptomyces scabiei 87.22 GAGGAGGACCGGGACGAGGTGCACGGGGACGAGGTGGACGGGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4979508-4979924	Sequence	SCAB_44361 - hypothetical protein (Protein is coded in complementary strand; from 4979924 to 4979508)