Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4999055
End position: 4999102
Length: 48

DNA sequence
>NC_013929, from 4999055 to 4999102 (48 bp); Streptomyces scabiei 87.22 GGTCTTCTTCGGGTCCTTCTTCGGGTCCTTCTTCGGGTCCTTCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4998840-4999889	Sequence	SCAB_44581 - hypothetical protein (Protein is coded in complementary strand; from 4999889 to 4998840)