Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5245267
End position: 5245296
Length: 30

DNA sequence
>NC_013929, from 5245267 to 5245296 (30 bp); Streptomyces scabiei 87.22 CGCAGCCGCGTGCAGCCGGGCGAAGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5245133-5246719	Sequence	SCAB_46741 - hypothetical protein (Protein is coded in complementary strand; from 5246719 to 5245133)