Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5281288
End position: 5281311
Length: 24

DNA sequence
>NC_013929, from 5281288 to 5281311 (24 bp); Streptomyces scabiei 87.22 CGGAGCCGGAGCCGGAGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5279918-5284912	Sequence	SCAB_47101 - bifunctional sensor kinase/response regulator (Protein is coded in complementary strand; from 5284912 to 5279918)