Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5309542
End position: 5309589
Length: 48

DNA sequence
>NC_013929, from 5309542 to 5309589 (48 bp); Streptomyces scabiei 87.22 TCCACGGTTCCGTCCACGGCTTCGTCCACGGTCCTGTCCACGGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5309320-5309601	Sequence	SCAB_47341 - hypothetical protein (Protein is coded in complementary strand; from 5309601 to 5309320)