Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5377705
End position: 5377729
Length: 25

DNA sequence
>NC_013929, from 5377705 to 5377729 (25 bp); Streptomyces scabiei 87.22 GGGGCGGGCCAGGGCGCGGCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5376173-5377789	Sequence	SCAB_47951 - phosphoesterase (Protein is coded in complementary strand; from 5377789 to 5376173)