Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5404355
End position: 5404390
Length: 36

DNA sequence
>NC_013929, from 5404355 to 5404390 (36 bp); Streptomyces scabiei 87.22 GCCCACCACCAGGCCCACCGCCAGGCCCAGCCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5404296-5404430	Sequence	SCAB_48271 - hypothetical protein (Protein is coded in complementary strand; from 5404430 to 5404296)