Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5469500
End position: 5469523
Length: 24

DNA sequence
>NC_013929, from 5469500 to 5469523 (24 bp); Streptomyces scabiei 87.22 CGTAGCCGTAGCCGTAGCCGTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5469391-5470752	Sequence	SCAB_49041 - hypothetical protein (Protein is coded in complementary strand; from 5470752 to 5469391)