Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5531561
End position: 5531584
Length: 24

DNA sequence
>NC_013929, from 5531561 to 5531584 (24 bp); Streptomyces scabiei 87.22 GACGAGGAGGAGGATGAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5530650-5532110	Sequence	SCAB_49511 - two-component system sensor kinase (Protein is coded in complementary strand; from 5532110 to 5530650)