Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5568983
End position: 5569027
Length: 45

DNA sequence
>NC_013929, from 5568983 to 5569027 (45 bp); Streptomyces scabiei 87.22 ACGACCTCAGGCGCTACTACCGCAGGCACTACGACCTCAGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5568728-5570359	Sequence	SCAB_49931 - major facilitator transporter (Protein is coded in complementary strand; from 5570359 to 5568728)