Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5687858
End position: 5687881
Length: 24

DNA sequence
>NC_013929, from 5687858 to 5687881 (24 bp); Streptomyces scabiei 87.22 GGTCGTCGTCGTGGTGGTGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5687820-5688314	Sequence	SCAB_51131 - hypothetical protein (Protein is coded in complementary strand; from 5688314 to 5687820)