Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5699991
End position: 5700026
Length: 36

DNA sequence
>NC_013929, from 5699991 to 5700026 (36 bp); Streptomyces scabiei 87.22 GGTGACGGAGGCGACGGAGGTGGCGGAGGTGACAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5699163-5699996	Sequence	SCAB_51241 - hypothetical protein
ORF... 5699993-5701819	Sequence	SCAB_51251 - hypothetical protein