Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 571844
End position: 571867
Length: 24

DNA sequence
>NC_013929, from 571844 to 571867 (24 bp); Streptomyces scabiei 87.22 GGGTCGGGCTCGGGGACGGGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 570917-572239	Sequence	SCAB_5041 - hypothetical protein (Protein is coded in complementary strand; from 572239 to 570917)