Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5729525
End position: 5729548
Length: 24

DNA sequence
>NC_013929, from 5729525 to 5729548 (24 bp); Streptomyces scabiei 87.22 CGGCGGAGGCGGCGGCCGCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5729371-5730699	Sequence	SCAB_51511 - hypothetical protein (Protein is coded in complementary strand; from 5730699 to 5729371)