Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5730763
End position: 5730786
Length: 24

DNA sequence
>NC_013929, from 5730763 to 5730786 (24 bp); Streptomyces scabiei 87.22 GGAGGCCGAGGCGGAGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5730696-5731277	Sequence	SCAB_51521 - sigma factor (Protein is coded in complementary strand; from 5731277 to 5730696)