Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5758521
End position: 5758574
Length: 54

DNA sequence
>NC_013929, from 5758521 to 5758574 (54 bp); Streptomyces scabiei 87.22 CGGCCACCCCGTCCGTCACGGCCACCCCGTCCGTCACGGCCACCCCGTCCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5758573-5759286	Sequence	SCAB_51781 - FMN-binding protein (Protein is coded in complementary strand; from 5759286 to 5758573)