Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5798641
End position: 5798688
Length: 48

DNA sequence
>NC_013929, from 5798641 to 5798688 (48 bp); Streptomyces scabiei 87.22 CCGTCGCGGTCGCGGTCGCCGTCGCCGTCGCCGTGGCCGTCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5797144-5798742	Sequence	SCAB_52141 - hypothetical protein (Protein is coded in complementary strand; from 5798742 to 5797144)