Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5826771
End position: 5826794
Length: 24

DNA sequence
>NC_013929, from 5826771 to 5826794 (24 bp); Streptomyces scabiei 87.22 CGGACGTGGACGCTGACGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5826275-5827270	Sequence	SCAB_52411 - hypothetical protein (Protein is coded in complementary strand; from 5827270 to 5826275)