Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5882358
End position: 5882382
Length: 25

DNA sequence
>NC_013929, from 5882358 to 5882382 (25 bp); Streptomyces scabiei 87.22 CCCCACCCCCGCCCACCACACCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5882089-5882379	Sequence	SCAB_52961 - hypothetical protein (Protein is coded in complementary strand; from 5882379 to 5882089)