Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5891632
End position: 5891664
Length: 33

DNA sequence
>NC_013929, from 5891632 to 5891664 (33 bp); Streptomyces scabiei 87.22 CCGTCAGGGCAGCGTCACGGCAGCATCAGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5891658-5892572	Sequence	SCAB_53071 - methylthioadenosine phosphorylase (Protein is coded in complementary strand; from 5892572 to 5891658)