Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6012283
End position: 6012309
Length: 27

DNA sequence
>NC_013929, from 6012283 to 6012309 (27 bp); Streptomyces scabiei 87.22 GGCCTCGGCGGCCTCGTCGCCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6012281-6012877	Sequence	SCAB_54151 rplY 50S ribosomal protein L25 (Protein is coded in complementary strand; from 6012877 to 6012281)