Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 604797
End position: 604820
Length: 24

DNA sequence
>NC_013929, from 604797 to 604820 (24 bp); Streptomyces scabiei 87.22 CCGGAGCCCGAGCCCGAGCCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 603900-604928	Sequence	SCAB_5351 - substrate-binding component of ABC transporter (Protein is coded in complementary strand; from 604928 to 603900)