Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6058562
End position: 6058585
Length: 24

DNA sequence
>NC_013929, from 6058562 to 6058585 (24 bp); Streptomyces scabiei 87.22 CGCCGATGCCGACGCCGGCGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6057037-6059574	Sequence	SCAB_54501 - ABC transporter (Protein is coded in complementary strand; from 6059574 to 6057037)