Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6074083
End position: 6074106
Length: 24

DNA sequence
>NC_013929, from 6074083 to 6074106 (24 bp); Streptomyces scabiei 87.22 CCGTGGCCGTGCTCGTGGCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6073956-6074555	Sequence	SCAB_54661 - hypothetical protein (Protein is coded in complementary strand; from 6074555 to 6073956)