Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6084657
End position: 6084680
Length: 24

DNA sequence
>NC_013929, from 6084657 to 6084680 (24 bp); Streptomyces scabiei 87.22 CCCGAGCCGGAGCCGGAGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6083667-6085850	Sequence	SCAB_54741 - hypothetical protein (Protein is coded in complementary strand; from 6085850 to 6083667)