Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6121215
End position: 6121259
Length: 45

DNA sequence
>NC_013929, from 6121215 to 6121259 (45 bp); Streptomyces scabiei 87.22 CTCCCGCTCTCCGCGTTCCCGCTCCCCGTGCTCACGCTCCCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 6121247-6122254	Sequence	SCAB_55061 cofD 2-phopspho-L-lactate transferase (Protein is coded in complementary strand; from 6122254 to 6121247)