Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6186796
End position: 6186849
Length: 54

DNA sequence
>NC_013929, from 6186796 to 6186849 (54 bp); Streptomyces scabiei 87.22 CGCCGTCGCCGCCGGGACCGTCCCCGCCGCCGGGACCGTCGCCCCCGCCGGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6186141-6188606	Sequence	SCAB_55521 - hypothetical protein (Protein is coded in complementary strand; from 6188606 to 6186141)