Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6200480
End position: 6200503
Length: 24

DNA sequence
>NC_013929, from 6200480 to 6200503 (24 bp); Streptomyces scabiei 87.22 CGGGCGCGGGCGCGGACGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6199154-6201385	Sequence	SCAB_55611 - techoic acid biosynthesis protein (Protein is coded in complementary strand; from 6201385 to 6199154)