Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6206414
End position: 6206458
Length: 45

DNA sequence
>NC_013929, from 6206414 to 6206458 (45 bp); Streptomyces scabiei 87.22 GGCCCCGGCCCCCGAAGCCCCGGCCCCTGACGCGCCCGCCCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6205794-6209648	Sequence	SCAB_55651 - hypothetical protein (Protein is coded in complementary strand; from 6209648 to 6205794)