Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6315480
End position: 6315506
Length: 27

DNA sequence
>NC_013929, from 6315480 to 6315506 (27 bp); Streptomyces scabiei 87.22 CGGTCTCGGAGGTCTCGGCGTTCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6314135-6315574	Sequence	SCAB_56661 - hypothetical protein (Protein is coded in complementary strand; from 6315574 to 6314135)
ORF. 6315426-6316682	Sequence	SCAB_56671 - hypothetical protein (Protein is coded in complementary strand; from 6316682 to 6315426)